I don't believe the coin toss is really 50-50 as we have always been led to believe by statistics. statistically the assumption is correct of course; stats being stats. In practical reality the engravings make the two sides, however infinitesimally, uneven.
This affects the spin because of effects such as; gravity, air resistance, magnetic characteristics of the metal of which the coin is made and the force of the toss.
Separately these factors won't affect outcome much; but in synergy with other factors not mentioned here to avoid rambling, the outcome will more likely be 49.999... - 50 Heads to Tails each time. thus making the "odds" in say a million tosses slightly lopsided indeed!
Sunday, September 11, 2011
Thursday, October 22, 2009
YCATS primers for Macroglossus study
By: Ahmad Bahjatu Saleh
Supervisor: Mr. Jayaraj Vijaya Kumaran
Introduction
The fruit and nectar bats of the genus Macroglossus found in peninsular Malaysia are of great ecological importance.
They distribute seeds and pollen through greater distances than is ordinarily obtainable.
The distinguishing feature of this genus is the long tongue with bristle-like papillae.
The long tongued fruit bat (M. sobrinus) and the long tongued nectar bats (M. m. lagochilus) were recently studied by Anwarali (2008) and Jayaraj (2009);
Using mtDNA Cytochrome b gene sequence analysis, the authors found that the two forms may in fact be in the same species.
The present study will attempt to further investigate these species using Y- Chromosome Conserved Tagged Sequences (YCATS).
YCATS are exonic sequences conserved between known intronic sequences so primers are available to amplify them.
Since these sequences are part of the Y-chromosome and they don’t cross over, the only change that can be found in them will be mutations that occurred during the evolutionary journey.
So if these species show a high degree of similarity in the YCATS amplified, it would go a long way in showing that they are part of the same species but different sub-species.
The strategy will be to use a specific primer to amplify Y-linked genes from the species by PCR; then analyze and compare the results.
Studying the Y-CATS will complement the studies on mtDNA (Hellborg and Ellegren, 2002) and further confirm earlier studies.
Methods
Specimens will be captured using mist nets set up at a height of 1.5 meters above ground.
Nets will be set up 6:30pm and checked periodically up until 12:30am to get trapped specimens.
Tissue samples to be used will be extracted from the pectoral muscle.
The total genomic DNA of the preserved sample will be extracted using Wizard® Genomic Purification kit according to manufacture’s directions.
PCR will be done using the DBY7 primer (Hellborg and Ellegren, 2002) . It yields about 400bp of product.
The primer sequences are:
Forward: GGTCCAGGAGARGCTTTGAA
Reverse: CAGCCAATTCTCTTGTTGGG
The master mix for PCR will be 25μl containing: 25ng DNA, 1x Gold PCR buffer, 2.5mM MgCl2, 5μM of primer, 2 μM dNTP and 0.25 AmpliTaq Gold Polymerase (Hellborg and Ellegren, 1992).
The temperature cycles will be: one cycle of 95oC for 10 minutes (denaturation), 20 cycles of 95oC for 30 seconds (denaturation), a touchdown from 60oC to 50oC over 20 cycles (annealing) and then 72°C for 1.50 min (elongation). This will be followed by 20 cycles of 95°C for 30s, 55°C for 1 min and 72°C for 1.5 min then a final extension step of 72°C for 10 min. (Hellborg and Ellegren, 1992).
the PCR product for each of the 3 sub-species will be sent for DNA sequencing.
Analysis
The Molecular Evolutionary Genetics Analysis (MEGA) (Kumar et. al., 2004) software will be used to analyze the sequences.
Bootstrap support values will be determined to see how heterogeneous the species are.
Kimura’s two-parameter model will be used to measure the amount of transition bias in order to more accurately determine the genetic distaces between the species.
Maximum parsimony will then be used to get the phylogenies and reconstruct the phylogenetic tree.
Expected Results
It is expected that after reconstructing the phylogenetic tree, the species under study will show a close phylogenetic link.
Anwarali and Jayaraj found that the species are closely related using mtDNA Cytochrome b gene sequences analysis.
It is expected that this study using YCATS will show a similar result because YCATS analysis complement mtDNA Cytochrome b gene sequences analysis.
References.
Hellborg L, Ellegren H (2002) Y chromosome conserved anchored tagged sequences (YCATS) for the analysis of mammalian male-specific DNA. Molecular Ecology, 12,, 283-291.
Jayaraj VK, Wong WL, Fong PH, Anwarali FA, Abdullahi MT (2009) Identification of microflora and parasites in guts of bats (Chiroptera) and revisiting the taxonomic status of nectar bats (Macroglossus) from Malaysia.
Kumar S, Tamura K, Nei M (2004) MEGA 3: Integrated Software for Molecular Evolutionary Genetics Analysis and sequence alignment.
Subscribe to:
Posts (Atom)
